Validating the Genome Decoder
code clojure
Sunday, July 7, 2013
Today we’ll validate the genome decoder we described yesterday, once again with our friend the yeast Saccharomyces cerevisiae (you may want to enjoy a slice of freshly-baked bread and a stein of Pilsner with this post).
We are aided in this case by the availability of the SacCer3 genome in both 2bit and FASTA formats. We can get the FASTA version in the same place we got the 2bit file:
mkdir /tmp/sacCer3_fasta cd /tmp/sacCer3_fasta wget http://hgdownload-test.cse.ucsc.edu/goldenPath/sacCer3/bigZips/\ chromFa.tar.gz tar xvzf chromFa.tar.gz
There is one FASTA file per sequence, starting something like this:
>chrI CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACC CACACACACACATCCTAACACTACCCTAACACAGCCCTAATCTAACCCTG GCCAACCTGTCTCTCAACTTACCCTCCATTACCCTGCCTCCACTCGTTAC CCTGTCCCATTCAACCATACCACTCCGAACCACCATCCATCCCTCTACTT ACTACCACTCACCCACCGTTACCCTCCAATTACCCATATCCAACCCACTG CCACTTACCCTACCATTACCCTACCATCCACCATGACCTACTCACCATAC
Back in the REPL, we can now spit out our own copy in the same format
(carrying over yeast
and other functions and vars from the previous
post).
First we need a new directory for the FASTA files we’ll generate:
(.mkdir (clojure.java.io/file "/tmp/decoded"))
Then we convert the keywords in our sequence to strings:
(defn genome-str " Convert e.g. [:A :G :T :C] to \"AGTC\" " [s] (->> s (map name) (apply str)))
A simple function will spit out the files, given a seq:
(defn write-seq " Write a (potentially very long) sequence of lines to a text file " [filename s] (with-open [wrt (clojure.java.io/writer filename)] (doseq [x s] (.write wrt (str x "\n")))))
And now for the actual converter:
(doseq [{:keys [name dna-offset dna-size]} (sequence-headers yeast)] (let [fname (str "/tmp/decoded/" name ".fa")] (write-seq fname (cons (str ">" name) (->> (genome-sequence yeast dna-offset dna-size) (partition-all 50) (map genome-str))))))
Did it work?
cd /tmp/sacCer3_fasta for f in *.fa; do diff $f /tmp/decoded/$f; done
No output – it succeeded! This builds more confidence that we didn’t
screw anything up in the decoder. (There are also a few other
hard-coded unit tests in test_core.clj
.)
Comparing file sizes, the FASTA files are about 4 times larger than the original 2bit file. If you tar and compress both versions, the FASTA files are still about 30% larger. It is left as as an exercise to the reader (with some spare hard disk) to do the same comparison with the human genome. (Though larger, the FASTA files would clearly be simpler to work with, and these days 4 GB isn’t too terribly much data; nevertheless, we’ll continue to use the 2bit file and decoder for our explorations.)
Now we are ready to begin playing with the actual data – starting in the next post.
Blog Posts (170)
Select from below, view all posts, or choose only posts for:art clojure code emacs lisp misc orgmode physics python ruby sketchup southpole writing
From Elegance to Speed code lisp clojure physics Wednesday, September 25, 2019
Common Lisp How-Tos code lisp Sunday, September 15, 2019
Implementing Scheme in Python code python lisp Friday, September 13, 2019
A Daily Journal in Org Mode writing code emacs Monday, September 2, 2019
Show at Northwestern University Prosthetics-Orthotics Center art Saturday, October 20, 2018
Color Notations art Thursday, September 20, 2018
Painting and Time art Tuesday, May 29, 2018
Learning Muscular Anatomy code clojure art emacs orgmode Thursday, February 22, 2018
Reflections on a Year of Daily Memory Drawings art Monday, September 18, 2017
Repainting art Sunday, May 14, 2017
Daily Memory Drawings art Tuesday, January 3, 2017
Questions to Ask art Thursday, February 25, 2016
Macro-writing Macros code clojure Wednesday, November 25, 2015
Time Limits art Saturday, April 25, 2015
Lazy Physics code clojure physics Thursday, February 12, 2015
Fun with Instaparse code clojure Tuesday, November 12, 2013
Nucleotide Repetition Lengths code clojure Sunday, November 3, 2013
Updating the Genome Decoder code clojure Saturday, July 13, 2013
Getting Our Hands Dirty (with the Human Genome) code clojure Wednesday, July 10, 2013
A Two Bit Decoder code clojure Saturday, July 6, 2013
Exploratory Genomics with Clojure code clojure Friday, July 5, 2013
Rosalind Problems in Clojure code clojure Sunday, June 9, 2013
Introduction to Context Managers in Python code python Saturday, April 20, 2013
Processes vs. Threads for Integration Testing code python Friday, April 19, 2013
Resources for Learning Clojure code clojure Monday, May 21, 2012
Continuous Testing in Python, Clojure and Blub code clojure python Saturday, March 31, 2012
Programming Languages code clojure python Thursday, December 22, 2011
Milvans and Container Malls southpole Friday, December 2, 2011
Oxygen southpole Tuesday, November 29, 2011
Ghost southpole Monday, November 28, 2011
Turkey, Stuffing, Eclipse southpole Sunday, November 27, 2011
Wind Storm and Moon Dust southpole Friday, November 25, 2011
Shower Instructions southpole Wednesday, November 23, 2011
Fresh Air and Bananas southpole Sunday, November 20, 2011
Traveller and the Human Chain southpole Thursday, November 17, 2011
Reveille southpole Monday, November 14, 2011
Drifts southpole Sunday, November 13, 2011
Bon Voyage southpole Friday, November 11, 2011
A Nicer Guy? southpole Friday, November 11, 2011
The Quiet Earth southpole Monday, November 7, 2011
Ten southpole Tuesday, November 1, 2011
The Wheel art Wednesday, October 19, 2011
Plein Air art Saturday, August 27, 2011
ISO50 southpole art Thursday, July 28, 2011
SketchUp and MakeHuman sketchup art Monday, June 27, 2011
In Defense of Hobbies misc code art Sunday, May 29, 2011
Closure southpole Tuesday, January 25, 2011
Takeoff southpole Sunday, January 23, 2011
Mummification southpole Sunday, January 23, 2011
Eleventh Hour southpole Saturday, January 22, 2011
Diamond southpole Thursday, January 20, 2011
Baby, It's Cold Outside southpole Wednesday, January 19, 2011
Fruition southpole Tuesday, January 18, 2011
Friendly Radiation southpole Tuesday, January 18, 2011
A Place That Wants You Dead southpole Monday, January 17, 2011
Marathon southpole Sunday, January 16, 2011
Deep Fried Macaroni and Cheese Balls southpole Saturday, January 15, 2011
Retrograde southpole Thursday, January 13, 2011
Three southpole Wednesday, January 12, 2011
Transitions southpole Tuesday, January 11, 2011
The Future southpole Monday, January 10, 2011
Sunday southpole Sunday, January 9, 2011
Radio Waves southpole Saturday, January 8, 2011
Settling In southpole Thursday, January 6, 2011
Revolution Number Nine southpole Thursday, January 6, 2011
Red Eye to McMurdo southpole Wednesday, January 5, 2011
That's the Way southpole Tuesday, January 4, 2011
Faults in Ice and Rock southpole Monday, January 3, 2011
Bardo southpole Monday, January 3, 2011
Chasing the Sun southpole Sunday, January 2, 2011
Downhole southpole Monday, December 13, 2010
Coming Out of Hibernation southpole Monday, September 13, 2010
Managing the Most Remote Data Center in the World code southpole Friday, July 30, 2010
Ruby Plugins for Sketchup art sketchup ruby code Saturday, April 3, 2010
The Cruel Stranger misc Tuesday, November 10, 2009
Photoshop on a Dime art Monday, October 12, 2009
Man on Wire misc Friday, October 9, 2009
Videos southpole Friday, May 1, 2009
Posing Rigs art Sunday, April 5, 2009
Metric art Monday, March 2, 2009
Cuba southpole Sunday, February 22, 2009
Wickets southpole Monday, February 16, 2009
Safe southpole Sunday, February 15, 2009
Broken Glasses southpole Thursday, February 12, 2009
End of the Second Act southpole Friday, February 6, 2009
Pigs and Fish southpole Wednesday, February 4, 2009
Last Arrivals southpole Saturday, January 31, 2009
Lily White southpole Saturday, January 31, 2009
In a Dry and Waterless Place southpole Friday, January 30, 2009
Immortality southpole Thursday, January 29, 2009
Routine southpole Thursday, January 29, 2009
Tourists southpole Wednesday, January 28, 2009
Passing Notes southpole Thursday, January 22, 2009
Translation southpole Tuesday, January 20, 2009
RNZAF southpole Monday, January 19, 2009
The Usual Delays southpole Monday, January 19, 2009
CHC southpole Saturday, January 17, 2009
Wyeth on Another Planet art Saturday, January 17, 2009
Detox southpole Friday, January 16, 2009
Packing southpole Tuesday, January 13, 2009
Nails southpole Friday, January 9, 2009
Gearing Up southpole Tuesday, January 6, 2009
Gouache, and a new system for conquering the world art Sunday, November 30, 2008
Fall 2008 HPAC Studies art Friday, November 21, 2008
YABP (Yet Another Blog Platform) southpole Thursday, November 20, 2008
A Bath southpole Monday, February 18, 2008
Green Marathon southpole Saturday, February 16, 2008
Sprung southpole Friday, February 15, 2008
Outta Here southpole Wednesday, February 13, 2008
Lame Duck DAQer southpole Tuesday, February 12, 2008
Eclipse Town southpole Saturday, February 9, 2008
One More Week southpole Wednesday, February 6, 2008
IceCube Laboratory Video Tour; Midrats Finale southpole Friday, February 1, 2008
SPIFF, Party, Shift Change southpole Monday, January 28, 2008
Good things come in threes, or 18s southpole Saturday, January 26, 2008
Sleepless in the Station southpole Thursday, January 24, 2008
Post Deploy southpole Monday, January 21, 2008
IceCube and The Beatles southpole Saturday, January 19, 2008
Midrats southpole Saturday, January 19, 2008
Video: Flight to South Pole southpole Thursday, January 17, 2008
Almost There southpole Wednesday, January 16, 2008
The Pure Land southpole Wednesday, January 16, 2008
There are no mice in the Hotel California Bunkroom southpole Sunday, January 13, 2008
Short Timer southpole Sunday, January 13, 2008
Sleepy in MacTown southpole Saturday, January 12, 2008
Sir Ed southpole Friday, January 11, 2008
Pynchon, Redux southpole Friday, January 11, 2008
Superposition of Luggage States southpole Friday, January 11, 2008
Shortcut to Toast southpole Friday, January 11, 2008
Flights: Round 1 southpole Thursday, January 10, 2008
Packing for the Pole southpole Monday, January 7, 2008
Goals for Trip southpole Sunday, January 6, 2008
Balaklavas southpole Friday, January 4, 2008
Tree and Man (Test Post) southpole Friday, December 28, 2007
Schedule southpole Sunday, December 16, 2007
How to mail stuff to John at the South Pole southpole Sunday, November 25, 2007
Summer and Winter southpole Tuesday, March 6, 2007
Homeward Bound southpole Thursday, February 22, 2007
Redeployment southpole Monday, February 19, 2007
Short-timer southpole Sunday, February 18, 2007
The Cleanest Air in the World southpole Saturday, February 17, 2007
One more day (?) southpole Friday, February 16, 2007
One more week (?) southpole Thursday, February 15, 2007
Closing Softly southpole Monday, February 12, 2007
More Photos southpole Friday, February 9, 2007
Super Bowl Wednesday southpole Thursday, February 8, 2007
Night Owls southpole Tuesday, February 6, 2007
First Week southpole Friday, February 2, 2007
More Ice Pix southpole Wednesday, January 31, 2007
Settling In southpole Tuesday, January 30, 2007
NPX southpole Monday, January 29, 2007
Pole Bound southpole Sunday, January 28, 2007
Bad Dirt southpole Saturday, January 27, 2007
The Last Laugh southpole Friday, January 26, 2007
First Delay southpole Thursday, January 25, 2007
Nope southpole Thursday, January 25, 2007
Batteries and Sheep southpole Wednesday, January 24, 2007
All for McNaught southpole Tuesday, January 23, 2007
t=0 southpole Monday, January 22, 2007
The Big (Really really big...) Picture southpole Monday, January 22, 2007
Giacometti southpole Monday, January 22, 2007
Descent southpole Monday, January 22, 2007
Video Tour southpole Saturday, January 20, 2007
How to subscribe to blog updates southpole Monday, December 11, 2006
What The Blog is For southpole Sunday, December 10, 2006
Auckland southpole Tuesday, January 11, 2005
Halfway Around the World; Dragging the Soul Behind southpole Monday, January 10, 2005
Launched southpole Sunday, January 9, 2005
Getting Ready (t minus 2 days) southpole Friday, January 7, 2005
Subscribe: RSS feed ... all topics ... or Clojure only / Lisp only